Continue cloning or start synthesizing?
The RBS Calculator on Genome Compiler
Among the many technologic developments improving the efficiency of biological processes is the RBS Calculator, a tool that predicts translation initiation rate and protein expression in bacteria. Developed by Howard Salis, the RBS calculator has the ability to predict the translation initiation rate for each start codon in an mRNA sequence. The tool then uses this information to design the ideal ribosome binding site to achieve optimal translation rate, and thus control protein expression. Genome Compiler has recently embedded the RBS Calculator into it’s all-in-one gene designer software, increasing the availability of the tool for academia and industry use.
The RBS Calculator can be used for both single protein and multi protein systems, in which the proteins in a genetic system are working together to produce a product such as recombinant vaccines or antibiotics. The RBS Calculator is most useful for multi protein genetic systems as these are the more difficult to engineer of the two.
In order to ensure that soluble protein is produced in a cell, it is imperative that the rate of translation is not faster than the rate of protein folding. While transcription and translation rates can be controlled, protein folding and secretion and membrane insertion rates cannot. Therefore it is not optimal to alter a cellular process to simply produce as much protein as possible, because if it cannot be folded fast enough it negatively impacts the process downstream. The goal is to optimize the entire system to produce more soluble and active protein.
Engineering the ribosome binding site sequence allows you to rationally control translation initiation rates to maximize the amount of soluble and active protein.
In addition to engineering ribosome binding site sequences, the Salis lab also utilizes promoters that respond to varying conditions with well-characterized transcription rates. All of the protein coding sequences in the genetic system are codon optimized for the specific host of interest. Codon optimization prevents an oversaturation of ribosomes bound to the mRNA. When there are too many ribosomes bound to the mRNA, it causes a “traffic jam” in translation elongation, which then causes the cell to grow very slowly. Codon optimization ensures that translation elongation will not be the rate limiting step in protein synthesis. The Salis lab also uses efficient transcriptional terminators that work with at least 95% efficiency. To reduce the chance that homologous recombination damages the engineered genetic system, the transcriptional terminators must be non repetitive. Finally, at the core of this design process, the optimal ribosome binding site sequences are designed to rationally control protein production rates to maximize the genetic system’s performance.
The researchers behind the RBS Calculator designed the model to understand how and why ribosomes bind better to certain RBS sequences to gain control over gene expression. According to statistical thermodynamics, the binding free energy of a ribosome to a specific mRNA will determine the probability that the ribosome will bind to it, which will be proportional to the mRNA’s translation initiation rate. The RBS Calculator calculates the ribosome’s binding free energy to a specific mRNA sequence using a 5-term free energy model that accounts for all known ribosome-mRNA and mRNA-mRNA interactions. Interestingly, by repeating this model calculation on all mRNAs inside the cell, the theory finds that increasing the translation rate of one mRNA can actually lower the translation rates of the other mRNAs in the system.
There are several molecular interactions that affect translation rate. These interactions are not independent from another; oftentimes making one interaction stronger weakens another interaction. Thus, it is quite difficult to design RBS sequences “by eye”, for example, when inserting a consensus Shine-Dalgarno sequence, strong mRNA structures may also be introduced, resulting in a lower translation rate. By accounting for all known interactions, the RBS Calculator’s free energy model can accurately predict translation rates for many mRNA sequences.
The RBS Calculator is a time saving machine for researchers. When attempting to design ribosome binding site sequences with a manual calculation or by eye, the odds of choosing the correct sequence to alter the translation rate by a desired factor are extremely slim. The RBS Calculator’s computational optimization algorithm uses a desired protein production level to determine the specific optimal RBS sequence. Rather than wasting time trying to guess the correct sequence, using the RBS calculator ensures the desired translation and protein production rate.
For more information about the RBS Calculator, check out our Q&A with Professor Salis.
Related posts
ATGTCGACACAGCGCCGCGATCCGTATGTGATTTCTGGTGCCAGCGGATCGTACAATGAAACAGATTTTTTGGGAAACTT
CTTAAATTTTATCGACAAGGAGGATGATGGTCAGCGTCCCGATGATGAGCCACGCTACACATACTGGCAACTGAACCAAA
ATTTGTTAGAGCGCTTATCGCGCTTGGGTATCGATGCTGAGGGGAAATTGGAAAAAGAGCCCCACGGACCTCGTGACTTC
GTTAAAATGTTTAAAGACGTAGATGCGGCTGTCGATGCAGAGGTTGTCCAATTCATGAACTCCATGGCCAAGAACAATAT
TACATATAAGGACCTGGTCAAGTCCTGCTACCACGTCATGCAATACTCTTGTAACCCTTTCGCGCAACCGGCATGCCCAA
TTTTCACCCAACTGTTTTATCGCTCCCTTCTGACAATCTTACAAGCACCGGGGGCTGGTTTGCGCAAACAGGCTGGAGGG
TCGAGCATGCGCAAAAAATTTGTTTTCGCTACGCCAACACTGGGACTTACAGTCAAGCGTCGTACTCAAGCCGCGACTAC
CTATGAGATCGAGAACATTCGCGCGGGCTTGGAGGCTATCATTAGCCAGAAGCAAGAAGAAGATTGTGTTTTTGACGTGG
TGTGCAATTTGGTAGACGCAATGGGTGAAGCGTGTGCCTCGCTTACCCGTGATGATGCTGAATATCTTTTGGGACGTTTC
AGTGTACTGGCAGATTCGGTACTGGAAACTTTAGCAACAATTGCCAGTAGTGGGATCGAATGGACGGCTGAAGCGGCCCG
TGACTTCCTGGAGGGGGTGTGGGGCGGTCCTGGGGCGGCACAGGATAATTTCATTAGTGTTGCAGAGCCCGTTTCCACTG
CCTCCCAGGCGAGTGCAGGGTTACTTTTAGGGGGAGGAGGTCAAGGCAGCGGCGGACGTCGCAAGCGTCGTTTAGCCACG
GTGCTGCCGGGGCTTGATCTGGGAGGCGGGGGTTCTGGTGGCAAAAAAAAGAAGAAGAAAAAAAAGTGA